How do Parkinson's researchers discover new knowledge? Part 2

Part 1 http://dialoguewithdisability.blogspot.co.uk/2013/05/how-do-parkinsons-researchers-discover.html

TOOL 1 – Polymerase Chain Reaction (PCR)

DNA replication

DNA is made up of two rows of subunits that are joined together to form a double helix shape. Between the rows of subunits A only binds with T and C only with G, so each subunit is facing its partner. The bond between subunits is strong but temporary. DNA replicates itself by breaking the subunit bonds and unzipping its two rows. New subunits bind to its exposed partner and subunits that are next door neighbours are glued together to form rows; thus, one DNA molecule becomes two. DNA replication is controlled by special proteins called DNA polymerases.

An analogy might help to visualise this: imagine a ladder is chopped in half lengthways, resulting in two halves with the rungs of the ladder exposed. Both halves are fixed one rung at a time; thus, one ladder becomes two

Original                        Copies

AATTCCGG               AATTCCGG                      TTAAGGCC

TTAAGGCC               TTAAGGCC         +          AATTGGCC

PCR is the replication of specific bits of DNA and is done in a test tube. All the ingredients (DNA, subunits, DNA polymerase, “primers”) are mixed together at different temperatures; initially DNA is separated into two rows, primers bind to both rows and then DNA polymerase adds each subunit to replicate the original DNA molecule.

The important stage in PCR is binding of the “primers”; primers are very short bits of DNA with a specific subunit sequence (e.g. ATCG and TAGC) designed to bind to a specific region in the DNA to be copied. When two unique primers are used the region of DNA between them will be copied.

             ATCG                                              GCTA                   

TCGGATAGCATTAAAAAAAAAAGGGGCCGTAAATTC     

The PCR cycle is repeated a number of times to generate lots of copies of the region. In this way repeats can be copied in enough quantity to be seen; DNA of different lengths (e.g. AAAAAAAAAA or AAAA) can be separated by size and visualised by running it through a solid agarose gel.

Once a repeat (or group of repeats) has been found to be present in sufferers the house to house searches can begin in that area; the genes surrounding a repeat are sequenced. A gene is a functional bit of DNA that generates a protein.