Using stem cells to treat Parkinson's

We all start out as the ultimate stem cell; a fertilised egg generated you with all 200 different cell types that make up the human body. This is the definition of what a stem cell is; it has the potential to develop (or differentiate) into different types of cell. The body normally uses stem cells as a special reserve of cells to replenish any differentiated cells that are naturally lost (e.g. replacing blood cells).

Stem cells are directed towards a specific cell type by chemical messengers that give the go ahead for the stem cell to transform its blank canvas into, for example, a nerve cell.

To do this, a stem cell first of all switches off genes that make it a stem cell and activates other sets of genes within itself (e.g. nerve cell genes). Since genes produce proteins, this changes the proteins in the cell (i.e. stem cell proteins are replaced by nerve cell proteins). These new proteins set to work changing the structure and function of the cell so it becomes a specific cell type (e.g. nerve cell).

As the nerve cell is emerging one of the genes that is switched on may contain a Parkinson's related mutation and will therefore produce a faulty protein. This faulty protein will lower the efficiency of the cell either by over activating or inhibiting a specific function. Cells are dynamic entities so will try to compensate and adapt to this inefficiency; they are remarkably successful at this since it typically takes 60 years for Parkinson's to emerge. However, as cells age they accumulate additional wear and tear; this natural slowing down within the context of the Parkinson's mutation will be too much and will trigger the cell to die. As more cells die, less dopamine will be produced and more Parkinson's symptoms will emerge.

This is when science strides into the picture and tries to find ways to restore dopamine levels; there are at least three ways we can do this; stop cells from dying, replace the cells that are lost or replace the dopamine. Science has been moderately successful in replacing dopamine by giving it in tablet form. However, this does nothing to address the underlying cause of Parkinson’s; the loss of nerve cells. Current research is looking towards replacing the A9 substantia nigra nerve cells lost in Parkinson's with equivalent cells grown in the lab from stem cells.

In the future the procedure will probably be something like this: skin cells will be taken from sufferers and these cells will be transformed back into stem cells (called induced pluripotent stem cells) and then driven towards a specific nerve cell type. A9 nerve cells will be selected and the Parkinson's mutations will be corrected by replacing the mutant DNA with normal DNA.

These corrected, induced A9 nerve cells will be transplanted into the substantia nigra of sufferers, where they will connect to other nerve cells in the brain and generate dopamine to restore movement.

A recent paper by Sundberg et al (2013; http://onlinelibrary.wiley.com/doi/10.1002/stem.1415/full) has shown in principle all steps (except replacing mutant DNA) are successful in treating Parkinson's in the rat and transplanted cells survive in primates for at least a year.

The ability to precisely replace DNA is an emerging technology (http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2443.2012.01599.x/full). A specific part of DNA, which contains a Parkinson's mutation, is targeted by zinc finger nucleases (ZHF); these are proteins which grab onto specific sequences of DNA and essentially carry a pair of scissors to cut the DNA at this point. Normally the cell glues this cut together again. If two ZHF's are used and they bind a certain distance apart then the intervening bit of DNA (containing the mutation) will be cut out. A new bit of DNA can be introduced into the cell and it can slot into the gap created by the ZHF's and glued in by the cell. Therefore, the normal DNA sequence of a gene is restored. This technology has huge potential in the treatment of all disease.

Exciting prospects are slowly coming into focus!

A sense of duty – should I take part in clinical trials?

Recent reports of possible advances in Parkinson’s treatment have brought to mind the importance of clinical trials as a means to scientifically test the benefit and risks of such treatment. Inevitably clinical trials need sufferers to take part, which has posted through my door a big moral dilemma: is my sense of duty towards the Parkinson’s community who will potentially benefit most from new treatments or towards myself as the preserver of my health? I do see that I might benefit from being in the clinical trial (assuming I’m not on the placebo) or from a positive outcome of the trial (assuming there is one) but the main issue for me is the safety of clinical trials.

Potential new treatments are experimental, that’s why they need to go through clinical trials, so therefore they carry a greater risk of the unknown; of course any treatment (but in particular drug treatment) has gone through extensive testing before it is accepted for use in humans. But the unknown risk is a stumbling block for me. I am a scientist you see (I have a DPhil in Genetics) and I simply cannot go into something without looking at the current state of knowledge in the scientific literature. I am lucky in that I have acquired the skills to understand the science and I know (because I’ve done it) that research also deals largely with unknowns. Again, I hear the objection, “if you don’t take part in clinical trials we will never know”.

For me it comes down to this: with the current state of my Parkinson’s being fairly tolerant of periods of good movement I have too much to lose if something went wrong and it is my sense of duty to myself to preserve my health for as long as possible that stops me from signing up. I imagine in the future when the extent of my decline shifts the emphasis to “I’ve got nothing left to lose” it will break down the barriers and I will be game for anything; inject me, probe me, scan me, break me, mend me! But, for now, I don’t want to risk the life I have at the moment; I want to enjoy it while it lasts. Is this selfish? Maybe. Understandable?

“Natural” remedies for Parkinson’s disease

It is completely understandable, when faced with any disease but especially a chronic and progressive one, to reach for any potential remedy or cure. But sometimes you can reach too far into spurious “natural” remedies.

Describing something as “natural” does not make it more likely to succeed; as if Mother Nature is handing out tried and tested compounds like a kindly old woman handing out tea and biscuits. Also, there is no opposition between “nature” and man-made “chemicals” because nature is a monumental chemical factory. For example, levadopa (the main drug treatment for Parkinson’s) is a precursor to dopamine but dopamine is naturally occurring so why is it “unnatural” (implying harmful) to take it in tablet form? When does the manipulations of humans render nature (assumed to be good) into man-made (assumed to be bad)? Bread doesn’t occur in nature, it requires the manipulations of wheat and yeast by us, but is seen as natural. You could argue that bread uses “natural ingredients and not chemicals” but nature is made of chemicals!

Most natural remedies are based on subjective experience and the testimony of one person. It probably goes something like this: I eat some chocolate and find my symptoms improve; therefore, the chocolate must be helping me get better; simple cause and effect. However, this misses many other possible reasons for the improvement; normal variation in symptoms, the feeling I’m doing something to help myself, the sugar in the chocolate gives me more energy etc. There could be many contributing factors that are the cause (and many more that are incidental to the improvement).

For 400 years the “reductionist” approach of modern Science has separated out the potential causes and tested each one in turn to see which one has the biggest effect. For example, you want to know what causes water to heat up. First you add the same amount of water to a small container and a large container at room temperature (the variable you are testing is the size of container) but see no increase in temperature. The size of container does not cause water to heat up. Next, you fill two small containers with the same amount of water at room temperature but you put a flame underneath one container (the variable you are testing is presence of the flame): the water heats up! Therefore, the flame is the cause of warmth in the water. If you used one small container and one large container and applied the flame to the larger container it is impossible to see the real cause; the size of container and presence of the flame are both varying at the same time (the equivalent is happening in the chocolate example).

The method of Science (separate out the potential causes and test each one in turn) is immensely powerful. Modern life is build upon it. But Science, by its very nature and by the nature of the complex world it tries to describe, is slow and laborious; many variables need to be rigorously tested. In the void of knowledge and practical application (e.g. treatments for Parkinson’s) there can flow many spurious claims for cause and effect relationships (e.g. chocolate (cause) results in improvement (effect)). Without applying the Scientific method, care should be taken over such claims.

See http://www.senseaboutscience.org/

How do Parkinson's researchers discover new knowledge? Part 5

Part 1: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover.html

Part 2: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover_29.html

Part 3: http://dialoguewithdisability.blogspot.co.uk/2013/05/how-do-parkinsons-researchers-discover_30.html

Part 4: http://dialoguewithdisability.blogspot.co.uk/2013/05/how-do-parkinsons-researchers-discover_31.html

TOOL 5 – Protein interactions

Proteins interact with each other in a vast network of Chinese whispers to activate, repress and control the many functions of a cell. The affect of the mutation may be to disrupt the interactions the protein normally has in the absence of the mutation. How is this studied?

Two genes (a and b) are copied by PCR and inserted into separate expression plasmids. When in cells the plasmids will express the proteins and if they interact A-protein and B-protein will reversibly bind to each other. The cell is then broken up and its contents exposed to a special protein called an antibody, which binds to specific proteins (e.g. A-protein). Therefore, the antibody will grab hold of A while B is attached to A (i.e. Antibody-A-B). The presence of B is seen using an antibody for B that triggers a visible chemical reaction. Therefore, if mutant A fails to interact with B there will be no chemical reaction.

Future treatment

Using the 5 research tools the criminal (i.e. mutation) is identified and a case is slowly built up to understand the extent of his crimes against the cell (i.e. what the mutated protein is doing). Once convicted, the criminal can be rehabilitated using drug treatment to modify his affect and restore the normal function of the cell.

How do Parkinson's researchers discover new knowledge? Part 4

Part 1: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover.html

Part 2: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover_29.html

Part 3: http://dialoguewithdisability.blogspot.co.uk/2013/05/how-do-parkinsons-researchers-discover_30.html

TOOL 3 – Expression plasmids

To understand a gene you must understand the protein it generates; the criminal has to be investigated to understand the extent of his crimes.

What does the mutated protein do?

Genes contain the information required to build proteins; genes are said to “express” or manufacture proteins and they can do this because different combinations of DNA subunits link together specific amino acids, which make up proteins.

Is it possible to express the mutated protein to help study it? Researchers use necklace-like circular DNA molecules called expression plasmids to express genes. First a gene is copied by PCR and then inserted into the expression plasmid (like adding links to a necklace). The expression plasmid is transferred into cells where it tricks the cell into expressing the gene it carries.

TOOL 4 – Green fluorescent protein

In every cell proteins are busy carrying out all of the essential functions needed to keep the cell alive. Different proteins work in different areas of the cell; imagine a cell is like a house and each room requires different furniture and appliances. If a protein is to be understood one of the crucial things to know is where in the cell it does its job. Normally, when you look at cells down a microscope they are colourless so how do we pin point one colourless protein out of thousands in a cell?

A special protein found in jellyfish called green fluorescent protein (or GFP) glows green when a particular wavelength of light is shone on it. By following the green glow you know where GFP is. Can this help locate other proteins? GFP is expressed from a GFP gene and, like all genes, the GFP gene is made up of A, T, C and G subunits. This is important; it means that a gene from a person (e.g. the gene we found mutated in the Parkinson’s family) can be attached to the jellyfish GFP gene to form a hybrid gene and therefore a hybrid protein: one half human and the other half jellyfish. Therefore, wherever the human protein goes the GFP protein goes too; when an expression plasmid containing the GFP hybrid gene is introduced into cells a particular part of the cell will glow green, demonstrating the human protein does its job there.

How do Parkinson's researchers discover new knowledge? Part 3

Part 1: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover.html

Part 2: http://dialoguewithdisability.blogspot.com/2013/05/how-do-parkinsons-researchers-discover_29.html

TOOL 2 – DNA sequencing

It is crucial to know the sequence of subunits in DNA because it is this sequence that forms specific proteins and these proteins carry out specific roles in the cell.

A clever modification of DNA replication makes sequencing possible: modified subunits are used that allow partner binding (A-T and C-G) but doesn’t allow the next subunit in the row to become glued to the modified subunit; thereby stopping replication at this point. For example, imagine the DNA to be read is made up of ATCGATCG. Four separate PCRs are set up with each containing a modified subunit (*) along with all four normal subunits. In the T* reaction replication will be stopped at two places: AT* and ATCGAT*; these can be distinguished by size. Therefore, taken together all four reactions will generate the following bits of DNA:

A* reaction       T* reaction         C* Reaction        G* Reaction

A*

                           AT*

                                                       ATC*

                                                                                      ATCG*

ATCGA*

                          ATCGAT*                            
                                                     ATCGATC* 

                                                                                    ATCGATCG*

Therefore, the sequence is read left to right as ATCGATCG. This technique formed the basis of the Human Genome Sequencing Project and is therefore one of the most important innovations in human history.

Finding the criminal

           

Genes within a region are sequenced in sufferers and non-sufferers. For example, gene X in non-sufferers has the sequence TTTATTCCG and in sufferers it is TTTGTTCCG: the fourth subunit A has been replaced by G. This is an A to G mutation (any subunit can be replaced by any other subunit). The criminal has been caught!

Mutations can have a range of affects: stopping the protein from being made, protein is made but it has lost its function, function is subtly altered or the change has no affect. One of the most important ways a mutation has an affect is changing the order of subunits (called amino acids) in proteins. It is the different strings of amino acids that give proteins their specific jobs in the cell.

How do Parkinson's researchers discover new knowledge? Part 2

Part 1 http://dialoguewithdisability.blogspot.co.uk/2013/05/how-do-parkinsons-researchers-discover.html

TOOL 1 – Polymerase Chain Reaction (PCR)

DNA replication

DNA is made up of two rows of subunits that are joined together to form a double helix shape. Between the rows of subunits A only binds with T and C only with G, so each subunit is facing its partner. The bond between subunits is strong but temporary. DNA replicates itself by breaking the subunit bonds and unzipping its two rows. New subunits bind to its exposed partner and subunits that are next door neighbours are glued together to form rows; thus, one DNA molecule becomes two. DNA replication is controlled by special proteins called DNA polymerases.

An analogy might help to visualise this: imagine a ladder is chopped in half lengthways, resulting in two halves with the rungs of the ladder exposed. Both halves are fixed one rung at a time; thus, one ladder becomes two

Original                        Copies

AATTCCGG               AATTCCGG                      TTAAGGCC

TTAAGGCC               TTAAGGCC         +          AATTGGCC

PCR is the replication of specific bits of DNA and is done in a test tube. All the ingredients (DNA, subunits, DNA polymerase, “primers”) are mixed together at different temperatures; initially DNA is separated into two rows, primers bind to both rows and then DNA polymerase adds each subunit to replicate the original DNA molecule.

The important stage in PCR is binding of the “primers”; primers are very short bits of DNA with a specific subunit sequence (e.g. ATCG and TAGC) designed to bind to a specific region in the DNA to be copied. When two unique primers are used the region of DNA between them will be copied.

             ATCG                                              GCTA                   

TCGGATAGCATTAAAAAAAAAAGGGGCCGTAAATTC     

The PCR cycle is repeated a number of times to generate lots of copies of the region. In this way repeats can be copied in enough quantity to be seen; DNA of different lengths (e.g. AAAAAAAAAA or AAAA) can be separated by size and visualised by running it through a solid agarose gel.

Once a repeat (or group of repeats) has been found to be present in sufferers the house to house searches can begin in that area; the genes surrounding a repeat are sequenced. A gene is a functional bit of DNA that generates a protein.

How do Parkinson's researchers discover new knowledge? Part 1

I will attempt to explain how researchers do their work by describing the tools they use in pursuit of knowledge. These tools include:

1. Polymerase Chain Reaction (PCR) to generate lots of copies of DNA

2. DNA sequencing to read the letters of DNA

3. Expression Plasmids to generate lots of protein from specific genes 

We will see how these tools are used in discovering changes in DNA (i.e. mutations) that cause Parkinson’s.

From the clinic to DNA

A Parkinson’s sufferer is diagnosed and he tells the doctors that some of his relatives also have the disease. This indicates that a mutation causing Parkinson’s might be passed through the generations in this family.

The one thing that is guaranteed to be passed from generation to generation is DNA. DNA is made up of four different subunits (A, T, C, G) and we inherit 3 billion of these subunits. Mutations occur when one subunit is replaced by another. How do we find the one subunit that is mutated in this Parkinson’s family?

DNA mapping

The 3 billion subunits we inherit (collectively called a genome) have distinct landmarks. Imagine you are chasing a criminal and you hear he’s hiding in a house somewhere in London. London has distinctive landmarks and boroughs throughout the city; to find the criminal you split the city into sections and systematically check CCTV and eye witness statements in each section. Lets say there are lots of sightings of the criminal near Big Ben so you narrow your search to houses in that area.

Looking for mutations involves a similar principle but the landmarks in DNA are repeating subunits. For example, at a particular location in the genome there is a repeat that in different individuals will either be AAAAAAAAAA or AAAA. Within the Parkinson’s family sufferers have AAAAAAAAAA while non-sufferers have AAAA. This means that a mutation (e.g. G to T) originally occurred near the repeat in an AAAAAAAAAA individual and both the longer repeat and the mutation causing Parkinson’s are inherited together. Therefore, without knowing the exact location of the criminal we know the area he is in.

But how do we know which repeat is present?